mouse b lymphocyte cdna library (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
93
Structured Review
TaKaRa
mouse b lymphocyte cdna library
Mouse B Lymphocyte Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+b+lymphocyte+cdna+library/Mouse+Brain+Marathon+-Ready+cDNA/us07704963-443-32-43
Average 93 stars, based on 287 article reviews
Mouse B Lymphocyte Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+b+lymphocyte+cdna+library/Mouse+Brain+Marathon+-Ready+cDNA/us07704963-443-32-43
Average 93 stars, based on 287 article reviews
mouse b lymphocyte cdna library - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Cloning:Article Title: Identification of a novel lipopolysaccharide-inducible gene with key features of both A kinase anchor proteins and chs1/beige proteins. Article Snippet: First-strand cDNA synthesis was primed with random DNA hexamers or oligo(dT) primers at 42°C for 1 h using the Superscript II RNase H Reverse Transcriptase cDNA Synthesis System (Life Technologies, Gaithersburg, MD). .. Cloning and sequencing of murine lba gene cDNAs Primers (forward: 59-AGAGAAGAGGAGAAGATGTGTGATC-39; reverse: 59-CCAGGCTCCATGCTTGTCTGTGAG-39) were designed from a 143-bp cDNA fragment obtained from our previous gene trap work (5) and combined with lGT10 forward (59-AGCAAGTTCAGCCTGGTTA AGT3-9) and reverse (59-TTATGAGTATTTCTTCCAGGG3-9) primers to amplify the lba gene cDNA from a Sequencing:Article Title: Identification of a novel lipopolysaccharide-inducible gene with key features of both A kinase anchor proteins and chs1/beige proteins. Article Snippet: First-strand cDNA synthesis was primed with random DNA hexamers or oligo(dT) primers at 42°C for 1 h using the Superscript II RNase H Reverse Transcriptase cDNA Synthesis System (Life Technologies, Gaithersburg, MD). .. Cloning and sequencing of murine lba gene cDNAs Primers (forward: 59-AGAGAAGAGGAGAAGATGTGTGATC-39; reverse: 59-CCAGGCTCCATGCTTGTCTGTGAG-39) were designed from a 143-bp cDNA fragment obtained from our previous gene trap work (5) and combined with lGT10 forward (59-AGCAAGTTCAGCCTGGTTA AGT3-9) and reverse (59-TTATGAGTATTTCTTCCAGGG3-9) primers to amplify the lba gene cDNA from a cDNA Library Assay:Article Title: Identification of a novel lipopolysaccharide-inducible gene with key features of both A kinase anchor proteins and chs1/beige proteins. Article Snippet: First-strand cDNA synthesis was primed with random DNA hexamers or oligo(dT) primers at 42°C for 1 h using the Superscript II RNase H Reverse Transcriptase cDNA Synthesis System (Life Technologies, Gaithersburg, MD). .. Cloning and sequencing of murine lba gene cDNAs Primers (forward: 59-AGAGAAGAGGAGAAGATGTGTGATC-39; reverse: 59-CCAGGCTCCATGCTTGTCTGTGAG-39) were designed from a 143-bp cDNA fragment obtained from our previous gene trap work (5) and combined with lGT10 forward (59-AGCAAGTTCAGCCTGGTTA AGT3-9) and reverse (59-TTATGAGTATTTCTTCCAGGG3-9) primers to amplify the lba gene cDNA from a Article Title: LPS-responsive Article Snippet: .. USA, 1996, 93:3947) and combined with Lambda GT10 forward and reverse primers (5′AGCAAGTTCAGCCTGGTTAAGT3′ (SEQ ID NO. 42) and 5′TTATGAGTATTTCTTCCAGGG3′ (SEQ ID NO. 43), respectively) to amplify the lrba gene cDNA from a |